DAY 562,501 TO DAY 567,198
Day 562,501 (APRIL 12th , CVD01,5:53 pm CovST)
(enters Suddhipanthaka) sweep clean sweep clean the floor mind ground
Now vaccinated bill gates is welcome to explore my dreams and thoughts I can feel the little gadgets traveling through my veins and pausing at numerous blockages and intersections scribbling their messages into my capillaries I already gave him my passwords my consumption is in patterns I buy things in succession copies of previous items ghost in the cellar buy of my head thinking into the mics mounted on the lil’ nano-vehicles
Ah but can you imagine the horror dreams of the Qanon and magats if them nanos get into their blood streams I mean holy fuck bill gates would wish for the finality of daith !!! after watching listening to them horror fever dreams THE GROUND IS CLEAN BUT NOT THE MIND a man is black once until he encounters a Minneapolis police officer and he becomes once black man daed he is for having expired plates so yeah you could have less riots if you stopped killing people on the basis of their color and its presumptuous of the authorities to assume riot and burning will result anytime black humans get together to protest the needless killing of another black human right then again its gonna burn lively until people can be black for their whole lives SWEEP, SWEEP, SWEEP, SWEEP…NEXT WORD? that’s my our day ahead and departed from maybe I did enough I hope I can only do so much we’ll pick up where we left off I will keep rwiting stay put i’ll be back tomorrow
Day 563,375 (APRIL 13th , CVD01,6:30 pm CovST)
(enters Suddhipanthaka) sweep clean sweep clean the floor mind ground
THIS from Twisted Sister’s jay jay French “The fact that a health crisis solution has been politicized and characterized as a threat to someone’s personal civil rights is just impossible to comprehend,” sweep sweep tick tick clock steady balls of noise we is should tick in unison be the noise you are silent in weave is your suggestion we can be this and yet even less in stir in cloudy skies THE GROUND IS CLEAN BUT NOT THE MIND no we is as we are naught of and cannot be any other not in our lifetime spread towards a
Horizon of progress even if we get or got there we wouldn’t know no we stumble with through the time we is bundled in huddled for and we remain as breathing holes in the mesh of specie moss cover speaking SWEEP, SWEEP, SWEEP, SWEEP…NEXT WORD? what is it america to you can it be or won’t it was the finish that they brought of air of that freedom becomes for the world a way to alleviate the suffer of from of something going from a person’s soil as chattel is the roped figure owned by state or monarch you are
always then human capital but america was relief from owned
I REALLY DO NOT KNOW that is twitch man of what america
your body is doesn’t want it there the best america is one unseen unheard runs as a muffled engine motors in
as idle of function in the grass as hidden leaves my tree my america is an engine of done and no other duties brought it is an america running parallel as silent program
in the background shadow of off and on as it changes through moments an incremental america not the one of seizures and grasps I did enough I hope I can only do so much we’ll pick up where we left off I will keep rwiting stay put i’ll be back tomorrow
Day 564,271 (APRIL 14th , CVD01,5:39 pm CovST)
(enters Suddhipanthaka) sweep clean sweep clean the floor mind ground
Consider this masks defy identity they do not deny it
Because im good with not being known now sure that’s not how I was raised no it was about your body expanding beyond the written sand of the thinkhole your brain soaks into but you forget then as always the diminishing of that being written through sand so hand me the wrap to conceal from those who wish me harm I will defy identity and not embrace it any further if daith don’t know your name or face it can’t distort you in the press mention of your having been is now rwitten out that way in code bunched at your anonymous fist THE GROUND IS CLEAN BUT NOT THE MIND the forgotten men are men and naked and forgotten because absent they are translucent light passes through not their light but the light of others that they wait for they are absent by choice
deference to another light rather not be seen or see be as of quiet is light they are angry light is made angry when passed through their skin angry as eyes are but not seen must not be seen in jeopardy they will the victim to their own design of course they are nimble of concealment
expert at confinement they aren’t forgotten by others but are
forgotten for others because they don’t want to be
here SWEEP, SWEEP, SWEEP, SWEEP…NEXT WORD? there is what we caught a leap a shiny clasp im of the understanding you know who you are an conceal it very well sing the plow back
keep your head down your hands numb and borrowed
I did enough I hope I can only do so much we’ll pick up where we left off I will keep rwiting stay put i’ll be back tomorrow
Day 565,240 (APRIL 15th , CVD01,5:53 pm CovST)
(enters Suddhipanthaka) sweep clean sweep clean the floor mind ground
His cursor is in his eye while zooming a telecast from our home our phone we learned to be televised no one need be visited but by the specter of ourselves ghosting ghostly in through the air occupying time in the figure of the screen land a map a soul is no more a portal than a hole
Sometimes I can see for miles and find that I just return to where I am it doesn’t take long to go around the world THE GROUND IS CLEAN BUT NOT THE MIND for the role i grew my forehead out made some changes in my patterns darkened my voice with muted tones a thread of well a tourniquet of on
there now i’m the president faustus unlighting the unlight
ready for the cameras my close up grotesque as it is fear to be fearing i’m waved to the gravel and bearing on, the epicenter is up ahead i should be there in ten minutes there it is live on the reality show in tourniquets laughing lost in fears this reality will break it will break everything will come apart it will it all will one part of at a time slipping
off into darkness doubled over we wince at
the thought of where am us we going off into american slip on live as if not being dead was proof enough SWEEP, SWEEP, SWEEP, SWEEP…NEXT WORD? no it really is bad out there and yet good and its shoving into itself and splitting fusion fission at the same time we could be better but some of us revel in the not of being adversarial in all things fine people will be daed because you wont move same difference I did enough I hope I can only do so much we’ll pick up where we left off I will keep rwiting stay put i’ll be back tomorrow
Day 568,088 (APRIL 16th , CVD01, 6;27 pm CovST)
(enters Suddhipanthaka) sweep clean sweep clean the floor mind ground
And so it was a transitional period and or The Down right Stupid Period as The White Father called it in all his speeches…everyday on the air (William s burroughs)….. no he left a sticky residue on all our politics orange and viscous good that thick on the poles that hold your bannister in place right don’t be thick about it AMERICA FIRST CAUCUS foist it on as anglo saxon voodoo do that shtick in your headpiece kill the patient to save the doctor what "America is a nation with a border, and a culture, strengthened by a common respect for uniquely Anglo-Saxon political traditions." I detect a hint of hitler emanating from the punctured bowel of democracy seen as a robust barrelshaped obese legend rolling away on all fours spilling its guts on the grease of the slope its been managed onto
Roll of drained and deflated IT IS ZERO TIME IN INFECTED AMERICA stupid becomes the virus of pushed by the RNA its matter detects THE GROUND IS CLEAN BUT NOT THE MIND
aaaauuguuaauaauugguugaagcaguuaauuaaaguuacacuuguguuccuuuuuguugcugcuauu
uucuauuuaauaacaccuguucaugucaugucuaaacauacugacuuuucaagugaaaucauaggauaca
aggcuauugaugguggugucacucgugacauagcaucuacagauacuuguuuugcuaacaaacaugcugauuuugacacaugguuuagccagcguggugguaguuauacuaaugacaaagcuugcccauugauugcugcagucauaacaagagaaguggguuuugucgugccugguuugccuggcacgauauuacgcacaacuaauggugacuuuuugcauuucuuaccuagaguuuuuagugcaguugguaacaucuguuacacaccaucaaaacuuauagaguacacugacuuugcaacaucagcuuguguuuuggcugcugaauguacaauuuuuaaagaugcuucugguaagccaguaccauauuguuaugauaccaauguacuagaagguucuguugcuuaugaaaguuuacgcccugacacacguuaugugcucauggauggcucuauuauucaauuuccuaacaccuaccuugaagguucuguuagagugguaacaacuuuugauucugaguacuguaggcacggcacuugugaaagaucagaagcugguguuuguguaucuacuagugguagauggguacuuaacaaugauuauuacagaucuuuaccaggaguuuucugugguguagaugcuguaaauuuacuuacuaauauguuuacaccacuaauucaaccuauuggugcuuuggacauaucagcaucuauaguagcuggugguauuguagcuaucguaguaacaugccuugccuacuauuuuaugagguuuagaagagcuuuuggugaauacagucauguaguugccuuuaauacuuuacuauuccuuaugucauucacuguacucuguuuaacaccaguuuacucauucuuaccugguguuuauucuguuauuuacuuguacuugacauuuuaucuuacuaaugauguuucuuuuuuagcacauauucaguggaugguuauguucacaccuuuaguaccuuucuggauaacaauugcuuauaucauuuguauuuccacaaagcauuucuauugguucuuuaguaauuaccuaaagagacguguagucuuuaaugguguuuccuuuaguacuuuugaagaagcugcgcugugcaccuuuuuguuaaauaaagaaauguaucuaaaguugcguagugaugugcuauuaccucuuacgcaauauaauagauacuuagcucuuuauaauaaguacaaguauuuuaguggagcaauggauacaacuagcuacagagaagcugcuuguugucaucucgcaaaggcucucaaugacuucaguaacucagguucugauguucuuuaccaaccaccacaaaccucuaucaccucagcuguuuugcag SWEEP, SWEEP, SWEEP, SWEEP…NEXT WORD? The ghost of a sky departing you What write could you book today the institutions we’ve constructed and have allowed to flourish and prevail pervasive across all over our skin body thought being all these institutions we constructed to mimic our anatomy some semblance of civility maybe they are running out of time as time has become confused with itself I did enough I hope I can only do so much we’ll pick up where we left off I will keep rwiting stay put i’ll be back tomorrow
Day 568,873 (APRIL 17th , CVD01, 5:11 pm CovST)
(enters Suddhipanthaka) sweep clean sweep clean the floor mind ground
3,004,371 global daeths in the all we are necrogeographies maps of daeth we are the contour lines our towering necropolis of clanging seeds mete out to build score and erase that’s it we roll into the sun
I did enough I hope I can only do so much we’ll pick up where we left off I will keep rwiting stay put i’ll be back tomorrow
Day 567,198 (APRIL 18th , CVD01, 4:49 pm CovST)
(enters Suddhipanthaka) sweep clean sweep clean the floor mind ground
WHAT THE FUCK? WE GAINED 1,675 BODIES? Fuck! All my rwiting worked! We revived 1,675 people rose from the daid as you might say shh don’t say it loud don’t bring attention to this daeth will want them back keep rwiting don’t let daeth know what we are doing
We have 1675 lifes return to breath aching out I hopes this rwiting helped THE GROUND IS CLEAN BUT NOT THE MIND and we’re live! in the post partum world the leaving for america isn’t it was better when it wasn’t when it was only that america we waited for so now live in humdrum in waiting in pausing from the outside grass we bring you america as defined as being as being something
to be to be something american and that is not america
ex falso sequitur quodlibet! goodnight! SWEEP, SWEEP, SWEEP, SWEEP…NEXT WORD? I did enough I hope I can only do so much we’ll pick up where we left off I will keep rwiting stay put i’ll be back tomorrow okay next week maybe we can regain some human lives in the mean time
Комментарии